Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST104707
Clone ID OST104707
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST104707
Sequence
GTGGGTGACCTGAACTGGGGTGATGAGGGGCTGAAGAGAATGTTCCGCCGCATCTACCGGCACCTGCGCCCTGGGGGTAT
TCTGGTCCTGGAGCCCCAACCATGGTCCTCCTACTGCAAGAGAAAGTCTCTCACGGAAACAATCTATAAGAACTACTTAA
AAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI26225

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138223927..138224493 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029726 (Mepce) NM_144913 methylphosphate capping enzyme Gene [Source:MGI (curated);Acc:Mepce-001]

 
Come back to gene ENSMUSG00000029726


For any suggestions or comments, please send an email to unitrap@crg.es