Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST104682
Clone ID OST104682
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST104682
Sequence
GCATGGTGCCCCTGTGAGCATCTCGTGGTGGTCAGCCAACAGCTGCGGTGTCTGAGCAGCCTTGCTGAGAGGAAGGAGAA
TGGCCTTGCAGTGAGTTTTCCTTTCACATGCCAAGTCTGGAGGAGCTTGCTGAAGTTTTGCAGAAGGGGCTAACTGACAA
CTTTGCTGATGTCCAGGTCTCAGTGGTTGACTGCCCAGATTTAACAAAGGAGCCATTTACCTTTCCTGTAAGAGGCATCT
GTGGGCAAACTAGAATTGCAGAAGTAGGAGGTGCGCCTTACTTATTGCCTCTTGTAAACAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI22706

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 15099131..15105939 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031938 (4931406C07Rik) NM_133732 RIKEN cDNA 4931406C07 gene Gene [Source:MGI Symbol;Acc:MGI:1918234]

 
Come back to gene ENSMUSG00000031938


For any suggestions or comments, please send an email to unitrap@crg.es