Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST104660
Clone ID OST104660
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST104660
Sequence
ATGTCCTGGTGAGCTTTACTCAGGAAGAATGGGCTTTGCTGGATCCTTCCCAGAAGNGTCTCTACAAAGATGTGATGCTC
GAAACCTATAGGAACCTCACTGCCATAGGCTATAACTGGGAAGAAGATAATATTGAAGAAGATTGTGAAAATTCTGGAAG
ACCCACTAGGCATCTTCAAAGGGATGGACCAAGTAATACTGGAGAGAAACCCTTTGAATGTATTCAATATGATGGAGCCT
TTGCAAGAAACCATCATCAGTTACATAAGGACACTGGATCTTTCATGTCTTATACTGATCGTCAAATACATAGAAGACCA
CACACTGAAGAAAAAGTCTATGATGGTAACCAATGTGGTAAAACCTTTTCATGTCACAACCATTTTGAAATCCGTAAAGG
AACATATACTGGAGAAAAACCCTATGAATGTAATCAATGTGGGAAAGCCTTTGCACGCCACAGCAATCTTCTAGACCATA
A
Sequence Type mRNA
Unitrap ID UNI16023

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 17222504..17224519 314
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067034 (Zfp97) NP_001005358 zinc finger protein 97 Gene [Source:MGI Symbol;Acc:MGI:105921]

 
Come back to gene ENSMUSG00000067034


For any suggestions or comments, please send an email to unitrap@crg.es