Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST104590
Clone ID OST104590
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST104590
Sequence
GTTTCTACATGGACAAACTTAATANNTACCGNCAGATGCACGGAGTNGCCATTACNTATNAAGAACTTANTACTTNGGGA
CCTCCACATGACAGAAGGTNNACATTNNANGCTNTAATATGATGANAATGAATNTCCAGANGCCAAAGGTANATCANNGC
AGGAGGCAAGAAACGCTGCAGCCAAATTAGCTTGTTGATATACTTGATAACGAAAACAAGGTGGATTGTCACACGAGTGC
ATCTGAGCAAGGCTTGCCCTATGGTAACTACATAGGCCTTGTCAATAGCTTTGCCCAGAAGAAAAAGCTGTCTGTAAATT
ATGAACAGTGTGAGCCCAACTCTGAGTTGCCTCAAAGGTGAGAGACTTCTACTGTTTCACTGTGTGNGAGCAGTGAAACG
GAGGCACTTCGTATGTAGTTTTCCAGAAATATTTGCCCCTTTTTATACATTCACTATGGAAGG
Sequence Type mRNA
Unitrap ID UNI26673

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 79273177..79277578 227
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024079 (Eif2ak2) NM_011163 eukaryotic translation initiation factor 2-alpha kinase 2 Gene [Source:MGI Symbol;Acc:MGI:1353449]

 
Come back to gene ENSMUSG00000024079


For any suggestions or comments, please send an email to unitrap@crg.es