Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST104421
Clone ID OST104421
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST104421
Sequence
GACTGAGCTGCCTGAATAATGTCAGGTTCTCCGCGTATAGGACTGCCATGAAGCTCAGAAGGCTCCAGAAGGCCCTTTGC
TTGGATCTCTTGAGCCTGTCAGCTGCATGTGATGCCCTGGACCAGCACAACCTCAAGCAAAATGACCAGCCCATGGATAT
CCTGCAGATAATTAACTGTTTGACTACAATTTATGATCGTCTGGAGCAAGAGCACAACAATCTGGTCAATGTCCCTCTCT
NTNTCTCCTTTATGTGGCACTGGGCATTTTCTTTATCCAAGGATTTGTTTTCACCAAGATTTAAAACAAGGGGTTCCTTT
CCTACTAAGAAGTTTTAAGTTTCATTCTAAAATCCAAGGTAGATAGAGGGCATAGTTTTGTTNNAATCTTTCCGTTNNAT
CTTTNAAATATTAGTTCNGNNGGGANTCTATCAAAATATTTTGAATAAAAACTGAGAGCTTTATTGCTGATTTAA
Sequence Type mRNA
Unitrap ID UNI6101

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 82335154..82450069 206
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045103 (Dmd) NM_007868 dystrophin, muscular dystrophy Gene [Source:MGI (curated);Acc:Dmd-001]

 
Come back to gene ENSMUSG00000045103


For any suggestions or comments, please send an email to unitrap@crg.es