Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST104318
Clone ID OST104318
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST104318
Sequence
GAACTGAGAACCGTGTGAGTACCTACTATGTGCCAGTCTGTGCCAGGCACTGGGGACACAGGTGGAAAAGTCCGAGTTGT
TCCCTGCTTTTCTGGTTCTCATTGTCCCGGAGCGTTATGTCATGCCCAGACCAGCAGAGGGCTCCATGAGGAGTTATAGA
AGATGCCCCGTGTCTCCGCTCCTCTGGTGCTGCTTCCTGCTTGGCTCTTGATGGTGGCCTGTAGCCCACACTCCCTGAGG
ATTG
Sequence Type mRNA
Unitrap ID UNI15215

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42616576..42627055 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032017 (Grik4) NM_175481 glutamate receptor, ionotropic, kainate 4 Gene [Source:MGI (curated);Acc:Grik4-001]

 
Come back to gene ENSMUSG00000032017


For any suggestions or comments, please send an email to unitrap@crg.es