Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST104275
Clone ID OST104275
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST104275
Sequence
GACTGAGGCTGCTGAATAATGANGGATCNCTGCTGGCCTACTNCGGTTATGGGGACACAGATGCCCGNNTCACTGCGGCC
ATCGCCAGTAACATCTGGGCCGCGTATGATAGGAACGGGAACCAAGCGTTTAATGAAGACAGTCTCAAATTTATCCTGAT
GGACTGCATGGAA
Sequence Type mRNA
Unitrap ID UNI13055

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88356276..88356441 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028062 (Mapbpip) NM_031248 roadblock domain containing 3 Gene [Source:MGI (curated);Acc:Mapbpip-001]

 
Come back to gene ENSMUSG00000028062


For any suggestions or comments, please send an email to unitrap@crg.es