Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST103607
Clone ID OST103607
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST103607
Sequence
CGGAAACGGCGCTGTTTCCCAGGACCTGGATGTGGAGAAACCCGACGCCAGCCCCACGTCACTTCAGCTGCGGTCCCAGA
TCGAAGAGTCTCTAGGCTTCTGCAGCCGCCGTGTCAACACCAGAAGTGGAAAGAAAGTAAGTCACTCTCCTCCCGCCCCG
GCCTGAGCTTCCAGGACGGCTCAGGGCTGGAGCTGGACGTGATAGTTTTTAACGTGTTCTGTGTGGCACATCTACCAAGG
TGGCCTTTGCAGTCCAGCTGGGGATGCCTGAGGCTTTTTAGGAGGGTTATTAATTTTGCATAACTAGTTGCAGGGGAGTC
CCAAATAAATGTCTGGAGCTAAAGGAAAGGTCAGGTAAGTCAATGGGGGTAGAGTTGCATCGTTGATGTTAGCTTTTAAT
AGAG
Sequence Type mRNA
Unitrap ID UNI7414

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 8533771..8570193 312
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015305 (Sash1) NM_175155 SAM and SH3 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1917347]

 
Come back to gene ENSMUSG00000015305


For any suggestions or comments, please send an email to unitrap@crg.es