Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRF516
Clone ID RRF516
Vector pGT0Lxf
Project baygenomics

Sequence tag RRF516
Sequence
GCTTTTCCCCTGCCGCCGCCGACTTGCGCGGAGGCGGAAGCTCGGGTGCGTTCAAGATTCGGCGTCACCCGTGATTCACC
GCCATGGCCGAGGAAGGCATAGCTGCTGGAGGTGTAATGG
Sequence Type mRNA
Unitrap ID UNI576

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 23506664..23507006 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061983 (AC160147.6) NM_011295 40S ribosomal protein S12 [Source:UniProtKB/Swiss-Prot;Acc:P63323]

 
Come back to gene ENSMUSG00000061983


For any suggestions or comments, please send an email to unitrap@crg.es