Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRF532
Clone ID RRF532
Vector pGT0Lxf
Project baygenomics

Sequence tag RRF532
Sequence
CGGGTACGCCTTCGCGGATCCTGCCGCCACCGGCCGAGCTTACTGAGCCGGCGGGAGCTGGCTTCCAACGGCCCAGCGGT
TCCTGCCACCGCGTCCTCGG
Sequence Type mRNA
Unitrap ID UNI2554

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40215339..40215438 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036822 (Topors) NM_134097 topoisomerase I binding, arginine/serine-rich Gene [Source:MGI (curated);Acc:Topors-001]

 
Come back to gene ENSMUSG00000036822


For any suggestions or comments, please send an email to unitrap@crg.es