Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRF540
Clone ID RRF540
Vector pGT0Lxf
Project baygenomics

Sequence tag RRF540
Sequence
TCCTGTTTAGAGGACTATTCTCTCTAAGCCGCTGCCAACTGAGAGGTCTGTGAAAGGGTCTTCGCCTCGTGCTCTGGTTT
TCCGACGTAGAGGGATTGGCCTGCTGAGGACTGGCTGCCCCAGTGCCTGGAATCTGAGGGAAAATGGCAAGTGTGGATGG
TGATTCCAGGCATCTTCTCTCTGAGGTGGAACATGAAGTAAGCCCTGGGCCTATGAACATCCAGTTTGATTCATCAGATC
TGAGATCTAAA
Sequence Type mRNA
Unitrap ID UNI8089

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 113450973..113459937 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047789 (Slc38a9) NM_178746 solute carrier family 38, member 9 Gene [Source:MGI Symbol;Acc:MGI:1918839]

 
Come back to gene ENSMUSG00000047789


For any suggestions or comments, please send an email to unitrap@crg.es