Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST103158
Clone ID OST103158
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST103158
Sequence
TTCTTCTGTGAGTTGCNTCTGGCCTCTGAAGAAGATAACANGGAAGACAGCATTTGGGAACCTCAGAAGANAGTTCCCAG
AAATCGTAGACAGCCTGCTTNCAAGGGATCCAAACGNTAGCATNGGGCCCAGGGCGAAGAANAGCTCCCNACANGTGGAT
GACAGAATCAAAAGATGTGGCTGTTAAGGAGGAGTTGAACAGCCCNGGTGGCTATTGTTGATGCAGATTTGGAAGAGAAA
AGCCACAAGTTGCAGACGACAAAGACTCTTAAAACTGCAGCAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI26693

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 86535787..86538585 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024135 (Srbd1) S1 RNA binding domain 1 Gene [Source:MGI Symbol;Acc:MGI:1925836]

 
Come back to gene ENSMUSG00000024135


For any suggestions or comments, please send an email to unitrap@crg.es