Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST103043
Clone ID OST103043
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST103043
Sequence
CATGGATGGGTAGCTGAGATAAAGGAAAGACAAAGGCTGGGGCTGNGGNGCTTGTTGCCTGACGCCCTGNGAGCTGAACT
CTGGGACTGCTGTTGCCTATCCCAGGAAGTGCTGCTTATTTGAGGGTGNCTGGTGGAAATGGGTAATCTCCGAGGATGTC
TGCAGCCTGCTTGTTGTGAGCTGTGACTGGGGAACCCCAAGGCAGAGGCAGGGGTCAGGCAGCTGAGAAGCAGCAGAAGA
ACACACTTAGATTCACCTTCTGTTCTTACAATAGTTCAAATATAGAATCGAAGTGAAATCTCATTGGATTATGCCTCTCT
AATGAAAAGCGAGCTGTTTGACTATACGGAAAATGTGCTGACATTAATTGCTTCTGTTTATTAAAGGTGATTTGCAAATT
AAAAAAAA
Sequence Type mRNA
Unitrap ID UNI13941

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 59033411..59033813 395
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055254 (Ntrk2) NM_008745 neurotrophic tyrosine kinase, receptor, type 2 Gene [Source:MGI Symbol;Acc:MGI:97384]

 
Come back to gene ENSMUSG00000055254


For any suggestions or comments, please send an email to unitrap@crg.es