Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRG033
Clone ID RRG033
Vector pGT0Lxf
Project baygenomics

Sequence tag RRG033
Sequence
AATCGGAGAAACTCCCCGTAGACTGAGGACCGCTTCTTCGCTTGTTCGCTGGACAGGAAGCGAAAATGTCGGAACGGAAA
GTTTTAAACAAATACTACCCACCTGACTTTGACCCATCGAAGATCCCGAAACTCAAGCTACCCAAGGACCGGCAGTATGT
GGTGCGTCTGATGGCCCCCTTCAACATGAGGTGTAAGACGTGTGGAGAATACATCTACAAGGGGAAGAAGTTCAATGCAC
GAAAGGAAACAGTCCAGAACGAGGCTTACCTGGGCCTGCCAATCTTCCGATTCTACATCAAGTGCACGCGCTGCTTGGCC
GAGATCACCTTCA
Sequence Type mRNA
Unitrap ID UNI7470

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56098596..56101584 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003208 (Ccdc94) NM_028381 coiled-coil domain containing 94 Gene [Source:MGI Symbol;Acc:MGI:1920136]

 
Come back to gene ENSMUSG00000003208


For any suggestions or comments, please send an email to unitrap@crg.es