Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST102715
Clone ID OST102715
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST102715
Sequence
ACTGGCCGTGGAGATGCCCAGCCGGACGCTCCGCCAAGCCAGCCATGAGTCCATCGAGGACAGCATGAACAGCTATGGCT
CAGAGGGCAACCTTAACTATGGAGGAGTTTGTCTAGCTTCAGATGCCCAGNTCANTGACTTCCTGGGGAGTATGGGACCA
GCACAGTTTGTGGGCCGCCAGACCCTGGCTACCACACCCATGGGGGATGTGGAGATTGGCTTGCAGGAGCG
Sequence Type mRNA
Unitrap ID UNI26708

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 163691263..163704919 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035226 (Rims4) NM_183023 regulating synaptic membrane exocytosis 4 Gene [Source:MGI (curated);Acc:Rims4-001]

 
Come back to gene ENSMUSG00000035226


For any suggestions or comments, please send an email to unitrap@crg.es