Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST102633
Clone ID OST102633
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST102633
Sequence
ATCACGTACTCGGGAAGCNTNTGCGAAATTATTTAAAAGAACGAGGGGATCAAACAGTGCTCATTCTTCATGCAAAAGTT
GCACAGAAGTCTTACCGGAAATGAAAAACCGATTNTTTTGCCCTCCTCCTTGGG
Sequence Type mRNA
Unitrap ID UNI8695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 54027200..54033283 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039191 (Rbpj) NM_009035 recombination signal binding protein for immunoglobulin kappa J region Gene [Source:MGI Symbol;Acc:MGI:96522]

 
Come back to gene ENSMUSG00000039191


For any suggestions or comments, please send an email to unitrap@crg.es