Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST102604
Clone ID OST102604
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST102604
Sequence
TGCCCAGCCTTGCCTGCTCCTTCAATGCGTTCGGGGGCCGCTGCTAAGTAAAAAGTCTTCATAGAGGGTTTGGATTACAG
GTGTATACCACCACACCANCTCATGNGATNATGGANATAAAACTCANGGCTTTG
Sequence Type mRNA
Unitrap ID UNI26711

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 155488047..155488289 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059939 (9430015G10Rik) NM_145557 RIKEN cDNA 9430015G10 gene Gene [Source:MGI Symbol;Acc:MGI:2444364]

 
Come back to gene ENSMUSG00000059939


For any suggestions or comments, please send an email to unitrap@crg.es