Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST102264
Clone ID OST102264
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST102264
Sequence
GAGCTTGGAGCTCAANGCTNTCCAAAGCCTTNTTACTCCTGGTGAATGGGCACAGCATGGTGAGTGTGTCCACTCCCATC
TCCGAAGTGTACGAGAGTGAGAGAGATGAAGACGGCTTCCTGTACATGGTTTATGCCTCGCAGGAGACATTCGGGACAGC
AATGGCTGTGTAAGACTCCAACAAAGCCAATGGTTGTTAAGCCCTTACCAAGGCAAAAAGGGATGTTACCAGCGGACGCT
GGACGGCTCACCACCCACAGATGAGAACGTAGGCACCCACATAGGGNATTAGGAACTGNTCATCAGCCAGAAACTGAGCT
CCATGCAAGTGCACTCAGCTTGGAAACTCGTCTAAACTAGGCTATTTTG
Sequence Type mRNA
Unitrap ID UNI20704

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 124120501..124120866 347
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031812 (Map1lc3b) NM_026160 microtubule-associated protein 1 light chain 3 beta Gene [Source:MGI Symbol;Acc:MGI:1914693]

 
Come back to gene ENSMUSG00000031812


For any suggestions or comments, please send an email to unitrap@crg.es