Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST102170
Clone ID OST102170
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST102170
Sequence
TGAGATGCTGCTGCTGCTGCTGGTGCCTCTCTTCCTCCGCCCCCTGGGCGCTGGCGGGGCTCAGACCCCCAACGTCACCT
CGGAAGGTTGCCAGATTATACATCCGCCCTGGGAAGGTGGCATCAGGTACCGTGGCTTGACTCGCGACCAGGTGAAGGCC
ATCAATTTCCTGCCTGTGGACTATGAGATTGAATATGTGTGCCGGGGCGAACGCGAGGTGGTGGGGCCCAAGGTGCGCAA
GTGCCTGGCCAACGGCTCCTGGACGGATATGGACACACCCAGTCGCTGTGTCCGAATCTGCTCCAAGTCTTATTTGACCC
TGGAAAATGGGAAGG
Sequence Type mRNA
Unitrap ID UNI20798

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37183638..37185410 206
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024462 (Gabbr1) NM_019439 gamma-aminobutyric acid (GABA-B) receptor, 1 Gene [Source:MGI Symbol;Acc:MGI:1860139]

 
Come back to gene ENSMUSG00000024462


For any suggestions or comments, please send an email to unitrap@crg.es