Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST102140
Clone ID OST102140
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST102140
Sequence
TGAGATGATGAACCAGCTGGGCCAATGAAAACCAACTCTACCAACAATCACAAAGATAAAAACTTGCGCCAGAGAAACAC
AAATTAAGTACTGCTTTTAATCTCTTTAGGTTCCTGAAAAACGATGGCAACATGACCTGCTAAGTTTTCTGCTTGGACCT
CTTTGGTCTCTCTCCCTTTCAAGTGAGCAACACCACAATGACCGTCTAAAGCATGCCTTATTTAGCCTCTCCTATAAGGG
TGACCTAGCCAGGTACATTTTAAACAATGCTTCAGTGTAGAAGGTGTAAACTATTTTGGGCTTGATGTGCTGTGAATGTT
GCTTTCCCTCCCTTTGTTAAAAATATTTAAATAGAAATGAAAAGGTCCTCTGAGGATCANATCATGAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI16428

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58498302..58499950 285
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032336 (Nptn) NM_009145 neuroplastin Gene [Source:MGI Symbol;Acc:MGI:108077]

 
Come back to gene ENSMUSG00000032336


For any suggestions or comments, please send an email to unitrap@crg.es