Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRG118
Clone ID RRG118
Vector pGT0Lxf
Project baygenomics

Sequence tag RRG118
Sequence
CAATATGGCTGCGCCCATGGAGAAGAAGGCGCATTCCAGAGCAGAAAGCCGACCCCAGCTCGCTCGCTCGCTCATGGACC
GTAGCGCGGAGTTCGGCCGGTGGAAGGCGCAGAGTCTGAGCAAGGCGGACCTTAGCCGCAAGGGCAGTGTGGACGAGGAC
GCGGTGGAGGTGGTGGAGCTCCTGAACTCGCGGGAAGAGTTTTTCACCACCAGCTCCTGCGCAGGGCGCATCCTCCTTCT
GGACGG
Sequence Type mRNA
Unitrap ID UNI8108

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 154259818..154260063 246
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047583 (Tyw3) NM_172474 tRNA-yW synthesizing protein 3 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Tyw3-001]

 
Come back to gene ENSMUSG00000047583


For any suggestions or comments, please send an email to unitrap@crg.es