Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST101493
Clone ID OST101493
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST101493
Sequence
TGAGACCTGAAAAATGTCTGAAAGTTCCAGCGACAGCGACTCATCTTGTGGCTGGACTGTCATCAATCATGAGGGTTCTG
ATATAGAGATCGTGAATTCTGCCACAGCCAGTGACAACTGTGGACTGACTCTAGAATGTTCCTTAGTAGAACAAGAGGAG
CTGCCCGTTCTTTATGTAGGGCATGGAGGTGAAGAAAGCAGCGCAAACAACACATCGTCAGTGGGAGAAACCATGTTGTC
ATCAATGAGAGAAACCAAGTCAGCAGCTGAGGTGGAGGAAGCACCTTCCCCTGAAGACAATGTCTATTTCGGAACTACTA
GTGACGATTCGGATATTGTTACACTTGAACCACCTAAGCTGGAAGAAATGGGGAACCAGGAAGTTACAATTCAAGAAGCG
CCCAGCTCAGATGACCTTAACATGGGCTCTTCCTCCAGCAGCCAGTACGCCTTCTGCCAGCCAGAACCCGGTATGGAGCT
Sequence Type mRNA
Unitrap ID UNI17235

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72845207..72849692 211
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034563 (Ccpg1) NM_028181 cell cycle progression 1 Gene [Source:MGI Symbol;Acc:MGI:1196419]

 
Come back to gene ENSMUSG00000034563


For any suggestions or comments, please send an email to unitrap@crg.es