Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRG159
Clone ID RRG159
Vector pGT0Lxf
Project baygenomics

Sequence tag RRG159
Sequence
TGTCCCCAACACCTTTCATGAACTCAAATCTGATAGGGAAAACATCAGAGAGAGGCTCATTTTCCCTGTACAGCAGAGAC
TCTGGACTCTCAGGCTGTCAGTCTAGTCTCCTGAGACAAGATCTAGGACTTGGGAGCCCGGCACAGCTGTCTTCTTCAGG
AAAGCCTGGAACACCATACTACTCATTCTCTGCCACAAGTTCGAGAAGAAGACCGCTCCATGATTCTGTAGCCCTAGATC
CTTTACAAGCGAAGAAAGTAAGAAAGGTGCCTCCTGGCCTACCTTCTTCT
Sequence Type mRNA
Unitrap ID UNI8113

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 71764812..71848258 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032228 (Tcf12) NM_011544 transcription factor 12 Gene [Source:MGI Symbol;Acc:MGI:101877]

 
Come back to gene ENSMUSG00000032228


For any suggestions or comments, please send an email to unitrap@crg.es