Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRG193
Clone ID RRG193
Vector pGT0Lxf
Project baygenomics

Sequence tag RRG193
Sequence
GCGGTATTTCTTACCTCCAAGTTTCCCCATCTCCAAGAAGGAGCTGAGTGTTATGAATTCAGAAGAAGTAATATCTTTTC
CTCTGAAAGAATACTTCAAGCAATATGAGGTGGGGCTCCAGAATCTGTGCCATTCCTACCAAAGCCGTGCTGATTCACGG
GCAAAAGCCTTCAGAGGAGAGCTTACGCACATCATAGAAAAAGTTTCGTGAGTCAGAGGAGAAGTTACATATGTTGAGGT
CCATTCTTTGTAGCACTCCTGCAAAAAGTGCAGG
Sequence Type mRNA
Unitrap ID UNI8118

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3585988..3588300 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034543 (Morc2a) NP_937805 microrchidia 2A Gene [Source:MGI (curated);Acc:Morc2a-001]

 
Come back to gene ENSMUSG00000034543


For any suggestions or comments, please send an email to unitrap@crg.es