Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRG204
Clone ID RRG204
Vector pGT0Lxf
Project baygenomics

Sequence tag RRG204
Sequence
CAGTCCCTCCCAGCAGAGGTGGGCTGTCTAGTCAATCTCATGACGCTGGCTCTCAGTGAGAATTCACTCACCAGTTTGCG
TGACTCTCTTGATAACTTGAAGAAGCTGCGGATGCTTGATTTACGGCATAATAAACTGAGAGAAATTCCTTCAGTGGTGT
ATAGGCTAGACTCTCTCACCACTCTCTATCTTCGCTTTAATCGCATAACTACTGTGGAAAAGGACATCAAAAACCTGCCG
AAGCTCAGCATGCTCAGCATCCGAGAGAACAAAATCAAGCAGCTGCCTGCTGAAATTGGTGAATTATGTAACCTCATTAC
CCTGGATGTAGCTCACAATCAACTTGAACACCTTCCAAAGGAGATTGGAAACTGCACACAGATAACCAACCTTGACTTGC
AGCACAATGACCTACTGGACCTCCCAGATACAATAGGAAACCTGTCCAGTTTAAATCGCCTTGGCCTGAGATACAATAGA
TTGTCAGCAATACCCAGATCATTAGCAAAATGCAGTGCACTTGAGGAGTTAAATTTAGAGAACAATAACATTTCTACTCT
ACCAG
Sequence Type mRNA
Unitrap ID UNI8122

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 54062576..54092167 300
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024976 (Shoc2) NM_019658 soc-2 (suppressor of clear) homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1927197]

 
Come back to gene ENSMUSG00000024976


For any suggestions or comments, please send an email to unitrap@crg.es