Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST100733
Clone ID OST100733
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST100733
Sequence
TTTCTAGCAAAGATATCAGTTATTTTGTTTCAAATAAAAAGGAAGCAAAGTATGCACAGACATTGGGTCGCAGTTNCTCC
TGTACCAAATCCAGAAATCTGCATATACATGCANAAACCACCTNTCCTCATCCCAGCCATGATGGAAGTTCCTTTAAGTC
TCAAGACAGAGTATGTTTGAGCCGAGGAAAATTGTTAGCTGAAAAAGCTGTGAAGGATCATGATTNTATTCCTGCTAATA
GTATATTATCAAATGCCTTATCATGGGGAGTAAAGATTCTTCATATTGATGACATTCGATACTACATTGAACAGANGAAG
AAAGCACTGAGTGCACTCAAGAAAATCCACTGCTTCTGGGAAGGATGCGGGGAAAAAAGCTGGTCCTGGAATACANAAGG
ACAANGAAGGGGGACTCANGAAGCCTTTTTTTAAAGGNTGNAAGATGTGGACCCGGTGTTACAGGGCCATTTTTACCTTC
AGCTTCT
Sequence Type mRNA
Unitrap ID UNI23798

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 8404872..8412288 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002297 (Dbf4) NM_013726 DBF4 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1351328]

 
Come back to gene ENSMUSG00000002297


For any suggestions or comments, please send an email to unitrap@crg.es