Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRG222
Clone ID RRG222
Vector pGT0Lxf
Project baygenomics

Sequence tag RRG222
Sequence
GAGCACCCAGCTGTGGAACCAAGAGCCCTCAATGGTGTGTCTTCCCCTGTGTCCTCCAACCCTAAGAGCCCTGTGCTGCC
AGAAGAGGCTCCCTTTTCCAGGCGCTTTGGTCTCCAGAAGACAGGGAGCACTGGTGCCTTGGGTCCTTCAGAAAGGAGGG
CTACAGAGGGCGTTCTCGGTCTGCAGCGCTCAGCCTCCTCCTCCCTCCTTGAGAAGGCCTCCACTCAGGCCAGGGAGCCC
CGTCTTGCCAGAATAACCCCTACCCCTGCCCAGAAAGTGCCAGAGCCCTTCACCCTGTATGAGGCTGCCACGCCTCCTTC
TTTGGATCACTCTGTTCCACCCTCCAGGAGGGAGCCTGGATCGATAGTGAAGCCAAATGTCCTCACAGCCTCTGCAGCGC
CCCTGGCCGACTCCAGGGACCGTCGGAGGTCCTACCAGATGCCTGTGCGTGATGAGGAGTCCGAGTCTCAGCGGAAGGCC
CGCTCCCGCCTTATGCGACAGTCTCGGAGGTCCACA
Sequence Type mRNA
Unitrap ID UNI8126

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4435541..4436687 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019254 (Ppp1r12c) NM_029834 protein phosphatase 1, regulatory (inhibitor) subunit 12C Gene [Source:MGI (curated);Acc:Ppp1r12c-001]

 
Come back to gene ENSMUSG00000019254


For any suggestions or comments, please send an email to unitrap@crg.es