Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST100314
Clone ID OST100314
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST100314
Sequence
GAACTGAGGAAATCTCAGCCTATCAAGGCAGACTTTTAAAAGGCTCTCTAAATATTTGGTNCGANAATNCCTTCTCTTTA
TATCTTTTGTGATCCCTNTACACATTGTGTCTAGACAATCAGGTNTAGTAAGTANGAATAGTAATTTATGAATTAAATAA
GACTTTTTCTACCTGAGATTTTATAANAATGGTCTATTAGCTCGCCAAAACAAACAGATGATGATGATGTTGTTTACTGT
TTGGAGCTGACTGNTCCTTAATGTATTAAGNCTTGNNTATTACANTGTATGAGCATAAGCACCGACCGGTCCTGTGGGNT
GGTGNCTATGCTGCNTCCCATCTGAANTACCTTAATTGCTNTGGNCTAATATTAAAACGAAAACTTCTGTT
Sequence Type mRNA
Unitrap ID UNI26736

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 84667884..84668389 276
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028086 (Fbxw7) NM_080428 F-box and WD-40 domain protein 7 Gene [Source:MGI (curated);Acc:Fbxw7-001]

 
Come back to gene ENSMUSG00000028086


For any suggestions or comments, please send an email to unitrap@crg.es