Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST100184
Clone ID OST100184
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST100184
Sequence
GCTGTTGCCTTCTGTGTTTGCTTTGTGCTGCCCCTTACAGAGAGGCCCCTTGGGTTGACCCGAGAAATTGCTAATAAAGC
TTTGAAGAAGTCTGATCCTTGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI26741

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100124193..100124295 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053654 (Krt42) NM_212483 keratin 42 Gene [Source:MGI (curated);Acc:Krt42-001]

 
Come back to gene ENSMUSG00000053654


For any suggestions or comments, please send an email to unitrap@crg.es