Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST100068
Clone ID OST100068
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST100068
Sequence
AAGATGCATTAAGAATTTTCCTTTTCTAGAGGAGCTACAACTGGCTGGTAACGACCTTTCTTTTATCCACCCAAAAGCCT
TGTCTGGGTTGAAAGAACTCAAAAGNCCTAACCCTCCAGAACAATCAGGTTGAAAACAGTACCCAGTGAANNNNATTCGT
GGNTCTNAGTNCCTNNNCAAGNCTCTACNCTTTAGATGCCAANGCATATTACCTCAGTCCCGGGAGGACAGTTTCTGAAG
AGACGTCAT
Sequence Type mRNA
Unitrap ID UNI1452

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 109810884..109836760 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050199 (Lgr4) NM_172671 leucine-rich repeat-containing G protein-coupled receptor 4 Gene [Source:MGI (curated);Acc:Lgr4-002]

 
Come back to gene ENSMUSG00000050199


For any suggestions or comments, please send an email to unitrap@crg.es