Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST100054
Clone ID OST100054
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST100054
Sequence
AATACATGAAGCAAATTTTGTCATGCGGGTGCAACCTGCCTCCCTTGTCAAGTGAGTACACCAGAGATGTCGGTTCCAAA
ACTCAGTTGGNGACAGCTAACCCCAGCATAATTCGCCAGAG
Sequence Type mRNA
Unitrap ID UNI26748

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 142816374..142825194 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030283 (St8sia1) NM_011374 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1 Gene [Source:MGI (curated);Acc:St8sia1-001]

 
Come back to gene ENSMUSG00000030283


For any suggestions or comments, please send an email to unitrap@crg.es