Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRG348
Clone ID RRG348
Vector pGT0Lxf
Project baygenomics

Sequence tag RRG348
Sequence
TGAGAACGGCACTGTCCAACATGACAGTGGAGACATACAATGACTGGGGGACCTGTATAGCCACTTCCTGTGAAAGCAGA
GATCCCCGGAAGCTTCACTGGCTTTTTGAGCTGCTCTTGGAGTCACCATTGAGTGGTGAAGGGGGGTCCTTTGTAGATGC
ATGCCGACTCTATGTGCTACAAGGTGGCCTTGCCCAGCAAGAGTGGAGAGTCCCTGAACTATTGCACAGACTTCTGAAGT
ACTTGGAACCAAAACTCACCCAGGTTTACAAAAATGTCAGAGAAAGAATAGGAAGTGTGCTGACCTACATATTTATGATA
GATGTTTCTTTGCCAAATACTGCTCCAACAACATCTCCTTGTATCCCTGAGTTTACTGCTCGCGTCCTAGAAAAACTGAA
ACCACTCACAGATGTGGATGAAGAAATTCAGAACCATGTTATGGAAGAAAATGGCATTGGTGAAGAAGATGAACGAACTC
AGGGCATTAAACTCTTAAAAACTATATTGAAATGGCTTATGGCAAGTGCAGGAAGATCTTTTTCTACAGCAGTCAAAGAG
CAACTTCAGCTTCTGCCTTTGTTCTTTA
Sequence Type mRNA
Unitrap ID UNI8133

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 30750637..30756113 211
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040850 (Psme4) NM_134013 proteasome (prosome, macropain) activator subunit 4 Gene [Source:MGI (curated);Acc:Psme4-001]

 
Come back to gene ENSMUSG00000040850


For any suggestions or comments, please send an email to unitrap@crg.es