Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRG363
Clone ID RRG363
Vector pGT0Lxf
Project baygenomics

Sequence tag RRG363
Sequence
AGGGAAGAAGATCTGGGCCTGGCACGCTGAGTTTGCAGAGCGTTTCACAGTAATGAATCAGTGCATTTACAGGGGAATGG
AAGAGCACAAGGAAAGACCCAAGCGGCCGAGGCAGAACAACTTCTCCATGTTTCCCTCTCCCAAAGCCTGGAATTTCAGA
GGGCGGAAACGAAAACAGAGTTCCCAGGATGAAGATGCTGTCAGCCTGTGCAGTCTTGACATAAGT
Sequence Type mRNA
Unitrap ID UNI8136

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 27966146..28078771 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021895 (Arhgef3) NM_027871 Rho guanine nucleotide exchange factor (GEF) 3 Gene [Source:MGI Symbol;Acc:MGI:1918954]

 
Come back to gene ENSMUSG00000021895


For any suggestions or comments, please send an email to unitrap@crg.es