Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST99812
Clone ID OST99812
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST99812
Sequence
CTGAGAGGGGTTGAGGCNAACAGCCAAATTCTGCCATCAGGAAGTGCGTCAGGGTGCAGCTCATTAAGAACGGGAAGAAG
ATCACAGCGTTCGTGCCCAATGATGGCTGCCTGAACTTCATTGAGGAAAATGATGAAGTTCTGGTTGCTGGATTTGGTCG
AAAAGGTCATGCTGTAGGTGATATTCCTGGAGTCCGCTTTAAGGTGGTTAAAGTAGCCAATGTTTCTCTGTTGGCTCTAT
ACAAAGGCAAGAAAGAAAGGCCAAGATCATAAAATTTGACAATGGAAACACAGTAATAAATTTTCATATTCTGAAAAAAA
AAAA
Sequence Type mRNA
Unitrap ID UNI16167

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 91063929..91064335 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049517 (Rps23) NM_024175 ribosomal protein S23 Gene [Source:MGI Symbol;Acc:MGI:1913725]

 
Come back to gene ENSMUSG00000049517


For any suggestions or comments, please send an email to unitrap@crg.es