Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST99694
Clone ID OST99694
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST99694
Sequence
ACCGCTGGTCCCAGGAAGATATGCTGACTCTGCTGGAATGCATGAAGAACAACCTCCCATCCAACGACAGCTCCAAGTTC
AAAACCACAGAGTCGCACATGGATTGGGAAAAAGTTGCGTTTAAGGATTTTTCAGGAGATATGTGCAAGCTCAAATGGGT
GGAGATTTCTAACGAGGTAAGNGCTTCCCACTTTTTGACTCCTGTAAATAAATACATATTGNATATGCTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI14831

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 102176124..102176353 226
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020923 (Ubtf) NM_001044383 upstream binding transcription factor, RNA polymerase I Gene [Source:MGI (curated);Acc:Ubtf-002]

 
Come back to gene ENSMUSG00000020923


For any suggestions or comments, please send an email to unitrap@crg.es