Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST99640
Clone ID OST99640
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST99640
Sequence
ACTGAGAAATGTTCGTNGGTGGTCTGAGCTGGGTTNCCAGCAAAAAAGCACTTANAGGATTATTTTACTANGCNTGGAGA
GGTTGCTGACTGTTCAATAANAATGGATCCCATCACTGGACGANCAAAGAAGNGTCNNNTNTATTCTCTTCAAAGATTCT
TCTAGTAGTGGAAAAGGTCTTAGATCAGAAGGAGCACAGGCTGGATGGTCGTGTCATTGACCCTAAAAAGGCTATGGCTA
TGAAGAAGGACCCTGTGAAGAAAATCTTTGTGGGAGGTCTAAACCCTGAAGCCACAGAGGAAAAGATCAGAGAATACTTC
GGCCAGTTTGGGGAGATTGAGGCCATTGAGCTTCCAATAGATCCCAAGTTGAACAAAAGACGGGGTTTTGTTTTTATTAC
ATTTAAAGAGGAAGATCCTGNGAAGAAAGTTCTGGAGAAGAAATTTCATACTGTCAGNGGAAGCNAGTGTGAAATCAAGG
NTGCCCAGCCCAAAGAGGTGTATCA
Sequence Type mRNA
Unitrap ID UNI26754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 51416160..51419132 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020358 (Hnrpab) NM_010448 heterogeneous nuclear ribonucleoprotein A/B Gene [Source:MGI (curated);Acc:Hnrpab-003]

 
Come back to gene ENSMUSG00000020358


For any suggestions or comments, please send an email to unitrap@crg.es