Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRG399
Clone ID RRG399
Vector pGT0Lxf
Project baygenomics

Sequence tag RRG399
Sequence
AGGTTTAGCCTCAATAAGGATCTTCGAACGCTGTGCCGCCGTCTGTATTCCCAGCTTCCCGTTTTCCTGTATTTTATTTT
ACCAGTTCTGGTCCACACTAGTTTTTAAGGCTGGAGGTTCTCGAGCGCCTGCTGCCAAGGACTCCCCCTCCCCCTCCTCC
CCTGATGGAGTCGGAGATGCTGCAGTCGCCTCTTATGGGACTCGGGGAGGAAGATGAGGCGGACCTTACAGATTGGAACT
TGCCTTTGGCTTTTATGAAGAAAAGACATTGTGAGAAAATCGAAGGCTCCAAATCTTTAGCGCAGAGCTGGAGAATGAAG
GATCG
Sequence Type mRNA
Unitrap ID UNI2866

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 119464960..119465284 319
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025583 (4932417H02Rik) NM_028898 RIKEN cDNA 4932417H02 gene Gene [Source:MGI Symbol;Acc:MGI:1921620]

 
Come back to gene ENSMUSG00000025583


For any suggestions or comments, please send an email to unitrap@crg.es