Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST99607
Clone ID OST99607
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST99607
Sequence
CTGAGAGACTCTGGCTNTTGAGGAGGANCTGGCTCAGAGCCTTNTTNACCTGNTGAATGTCNNNGCCAGGNGGACACCNA
GCTNNAGCTAGCTTGNANGTGGAGCTCCAGAGGACCAGCAAGGAGGACACCTGTGTGCAGGCTAGGCTACGTCAGCTCAT
CACAGAGCTGCAGGAGCTCAGGGAGATGGAGGAAGAGCTCCAGCGCCAGGAGAGGGATGTAGATGAGGACAACACCGTCA
CCATCCCCTCTGCAGTGTATGTGGCTCATCTCTATCACCAAATTAGTAAAATACAGTGGGATTATGAATGCGAGCCAGGG
ATGATCAAGGGCATCCACCACGGCCCCACAGTGGCCCAGCCCATCCACTTGGACAGTGCACAGCTCTCGCCGAAGTTCAT
CAGTGACTACCTCTGGAGCCTGGTGGACACCACGTGGGAGCCAGAGCCTTGACCTCATACCTTGCACAGAACTGGGGTTG
AGGGAGCCAAGGAGGGGATCACTCTAAAATTAAATGTCTGTATGTGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI25962

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21560546..21562275 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074476 (Spc24) NM_026282 SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1914879]

 
Come back to gene ENSMUSG00000074476


For any suggestions or comments, please send an email to unitrap@crg.es