Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRG403
Clone ID RRG403
Vector pGT0Lxf
Project baygenomics

Sequence tag RRG403
Sequence
CAGAACCAGAAGGTCCAGGTCAAGGCCTCGTCCACGCTCACATAGTAGAAGCAGTGAAAGATCCAGTCACAGAAGAACCC
GTAGCAGGTCCAGGGACAGAGACAGACGTAAAGTCCGGGACAAAGAGAAAAGAGAAAAGGAGAAGGATAAAGGCAAAGAC
AAAGAAGTGCACAGCATCAAACGCGGGGATTCTGGAAACATCAAAGCTGGATTAGAACATCTGCCTCCAGCTGAGCAGGC
CAAAGCCAGACTGCAATTGGTCCTTGAAGCTGCTGCAAAAGCTGATGAAGCATTAAAAGCCAAAGAAAGGAGTGAGGAAG
AAGCAAAGAGAAGAAAAGAAGAAGACCAAGCCACCCTGGTAGAACAAGTCAAAAGAGTAAAGGAAATCGAAGCAATTGAA
AGTGATTCTTTTGTTCAGCAGACATTCAGATCAAGTAAAGACGTCAAAA
Sequence Type mRNA
Unitrap ID UNI8142

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 66886456..67153935 178
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034544 (Rsrc1) NM_025822 arginine/serine-rich coiled-coil 1 Gene [Source:MGI Symbol;Acc:MGI:1914130]

 
Come back to gene ENSMUSG00000034544


For any suggestions or comments, please send an email to unitrap@crg.es