Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST99564
Clone ID OST99564
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST99564
Sequence
GACTGAGCCGACTGGTCCAACTGCCAGGTCTCTACCCAAATCAATTGGAAAGTCACCCAAAGGCCTCTGCTTTGCTGGAG
GGCCAATGTGATGTAGTGATGTCCCTGTCTCTGCTGAAATCCTTCCTCATCTTGTGGAAGCGTCTGGAAGTGCTGAAGGA
ACACTGGGGCCGATTCAAGCTTCGAGGGCAGGACATCAACTCTGCCTTGCTGCATAGACAGTTCTCAGAGCTCTACGAAG
CTGAGATTCTCTACCCCAGCATGAAAGCTCTAGCCAGGCAGATGGGCAAAGAAGATGAATTTGAAGAACTTATGCTAAGA
AGCCAATCTATCCTTCCCCCAAAGGGAGCCTCAGAAATTGAAATAAAAACTCAGCAGGTACANGGCTCTCTTCAGACTGC
CTTGTGACNCTGGCATGGAAAACTT
Sequence Type mRNA
Unitrap ID UNI22884

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 41299984..41301199 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075225 (5033413D22Rik) NM_029493 RIKEN cDNA 5033413D22 gene Gene [Source:MGI Symbol;Acc:MGI:1923223]

 
Come back to gene ENSMUSG00000075225


For any suggestions or comments, please send an email to unitrap@crg.es