Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST99343
Clone ID OST99343
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST99343
Sequence
AGCAAATTACGGAGTTGGAGGACAGTATGAGCCCCATTTTGACTTTGCAAGGAAAGATGAGCCGGATGCCTTTAGAGAGC
TTGGGACAGGAAATAGGATTGCCACGTGGCTGTTCTATATGAGCGATGTGTCTGCTGGAGGAGCTACTGTTTTTCCTGAA
GTGGGAGCCAGTGTTTGGCCCAAAAAAGGCACTGCTGTCTTCTGGTATAATCTGTTTGCCAGTGGGGAAGGAGATTACAG
TACACGGCATGCAGCCTGTCCCGTGCTAGTTGGAAACAAATGGGTATCCAACAAATGGCTCCATGAACGTGGACAAGAAT
TTCGAAGGCCGTGCACCCTGTCAGAATTGGAATGACAACCAGGCTTCCCTTGGCTCCTGTTGTCCTCTAACGCACCAGGC
ACGAT
Sequence Type mRNA
Unitrap ID UNI26757

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 58828039..58833872 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019916 (P4ha1) NM_011030 procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha 1 polypeptide Gene [Source:MGI Symbol;Acc:MGI:97463]

 
Come back to gene ENSMUSG00000019916


For any suggestions or comments, please send an email to unitrap@crg.es