Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRH013
Clone ID RRH013
Vector pGT0Lxf
Project baygenomics

Sequence tag RRH013
Sequence
GGGGCGTCAGCAGCTCCGGCTCTTGCCCTCGCAGCCCGCAATCTGGTGGGAACCCGGACCCTTGAGAGCCGTGGCCATGA
AGAGCCTCAAGTCCCGACTGTGGAAGCAGGACGCGCCCGGCCCCACGTCACCCTCATCGCCCACCGCGGTGGCCAGCAC
Sequence Type mRNA
Unitrap ID UNI8152

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 60642340..60642498 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034485 (Uaca) NM_028283 uveal autoantigen with coiled-coil domains and ankyrin repeats Gene [Source:MGI Symbol;Acc:MGI:1919815]

 
Come back to gene ENSMUSG00000034485


For any suggestions or comments, please send an email to unitrap@crg.es