Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST98960
Clone ID OST98960
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST98960
Sequence
GAAAGAAGCTGACGACAGAAGGGCTGAGGACCTGGGCACNACCACTTACCGACCACTTCGTNGNCTGGCTGAAAGANCGT
TACCTTCCTGCCAACTAAAGAGCAGAAATAGTCTACAGATAAGGAAAACTGAAGTAAAATGGCCTCATAATCAATNCATC
CTTTGGTACCAAGATATGTACACACGGACAGCTCTCAGACGGAATCCTAGCTGCATAGAGTGCTCATCCTGCCAAATNAG
CCCAGGCTCTGCTCACTAGTGATTCCACACACTAGCAATTCCACATGGTAGGTCATCATTGCCCTTNTTGAACTCAAGTG
CAAGTGTAAGTGTGAGCTCACCTGGCTATGCCATGTATCTTACTCATAAACCTCTTCCCATCGCCCTGAGGCCAACTGCT
TATCACCTCCTGCTGACTTCCTTTCCTCACTATTGCTTCCGTCGGTCAGTCCCTCTTCTGTCATCACTGTTTAGCTTATG
GACTTTGNTGNNGGGAGCCGCGCCCACATTTCGNCGNTACAAGATGGCGCTGACAGCTG
Sequence Type mRNA
Unitrap ID UNI26762

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91709025..91710705 305
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074911 (AC131691.4) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q3TUQ9]

 
Come back to gene ENSMUSG00000074911


For any suggestions or comments, please send an email to unitrap@crg.es