Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST98915
Clone ID OST98915
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST98915
Sequence
GACTGAGGTCAGACCAAAGCGTGAATCTGGAAGAAAAGTTCAGTCTGGAAATATCAATGCTGCAAAGACAATTGCNGACA
TCATCCGGACCTGCTTGGGACCTANATCTATGATGAANATGCTTTTGGACCCAATGGGAGGCATCGTGATGACCAATGAT
GGCAATGCCATTCTTCGAGAGATTCAAGTCCAGCATCCCGCAGNAAAGTCCATGATTGAAATTAGCAGGACCCAGGATGA
AGAGGTTGGAGATGGGACCACATCAGTAATTATTCTTGCGGGAGAAATGCTCTCTGTGGCTGAACACTTCCTAGAGCAGC
AGATGCACCCAACAGNGGGGATCAGTGCTTACCGCATGGCACTGGATGAT
Sequence Type mRNA
Unitrap ID UNI4903

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88103262..88109026 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001416 (Cct3) NM_009836 chaperonin containing Tcp1, subunit 3 (gamma) Gene [Source:MGI Symbol;Acc:MGI:104708]

 
Come back to gene ENSMUSG00000001416


For any suggestions or comments, please send an email to unitrap@crg.es