Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST98910
Clone ID OST98910
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST98910
Sequence
ATTTAGCGACAGCTGTCTGAGCCCANCCTCCCTTCCCTCCTNAGTCAGGAGTTCCTGGAGATAGTCGCCCCAGCTACCAC
CGGCAGATGTCAGAGCCCATTGTCCCCGCAGCTCCNCCACCCCTTCAGGGATTCAAGCAGGAATACCATGACCCACTGTA
TGAACATGGGGTCCCTGGGATGCCTGGTCCTCCAGCACATGGGTTCCAGTCACCCATGGGGATCAAGCAGGAGCCCCGAG
ATTACTGTGCTGACTCAGGTTAGCGCAAACTCACTGCATCGGCGTCTATGTTCTCACCTGGCTGTCTGATGAGCATTGGG
CTGCTCTCTTCGAGGGTCTAAGAATTGCCTTTCGGGACTGAAGATTGTAGCAACGCAATATCCTGGGGTTCATGCCCAGC
ACTTCTAAAACCAAATCAACAACCCTCAAAGAGCTTAATGAATTAGTTCATTGNATTCAGAAGNGNGAAAATACACCTAA
GGCGAATTTGAAGCCTG
Sequence Type mRNA
Unitrap ID UNI1985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22401505..22402002 476
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]

 
Come back to gene ENSMUSG00000013089


For any suggestions or comments, please send an email to unitrap@crg.es