Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST98348
Clone ID OST98348
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST98348
Sequence
TGAGGTTTCTCTACACATAAAAATCTTTTCAAAAATACGGAGCAAGAATGGCAGCAGTAAACACAGACACTAAACTTTGG
GCCTGAATG
Sequence Type mRNA
Unitrap ID UNI10722

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 89250977..89251061 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048000 (Gigyf2) NM_146112 GRB10 interacting GYF protein 2 Gene [Source:MGI Symbol;Acc:MGI:2138584]

 
Come back to gene ENSMUSG00000048000


For any suggestions or comments, please send an email to unitrap@crg.es