Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRH119
Clone ID RRH119
Vector pGT0Lxf
Project baygenomics

Sequence tag RRH119
Sequence
AAGCTCTCTGGCCCAGTTGAAGGAAACTGGCAGTGCCTTTGAAGTGGAACATGAATGCTTGGGCAAATGTCAGGGTCTCT
TTGCGCGTCAGTTTTATGTTCAGCCCGACGCTCCCTGTATCCAGTGCCTGGAGTGCTGTGGAATGTTTGCTCCCCAGACG
TTCGTCATGCATTCGCACAGATCCCCTGACAAGAGAACTTGCCATTGGGGCTTTGAGTCAGCCAAGTGGCACTGTAGACC
TTCATGTGAACCAAAAATACCTAGGGACACCCGAAGAAAAGAAACTGAATGATTATTTTAGAAGAAATGAAGGAGAAGTT
TAGCATGAGAAATGGAAAGAGAATCCAATCA
Sequence Type mRNA
Unitrap ID UNI8170

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 30996990..30997338 337
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027660 (Skil) NM_011386 SKI-like Gene [Source:MGI (curated);Acc:Skil-001]

 
Come back to gene ENSMUSG00000027660


For any suggestions or comments, please send an email to unitrap@crg.es