Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST97866
Clone ID OST97866
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST97866
Sequence
AACTGAGGCTTTTGTGGCTACAGGAACCAATCTGTCTCTCCAGTTTTTTCCGGCCAGCTGGCAGGGAGAACAGCGACAAA
CACCTAGCCGGGAATATGTCGACTTAGAGAGAGAAGCAGGCAAGGTATACTTGAAGGCTCCCATGATTCTGAATGGAGTG
TGTGTTATATGGAAGGGCTTGGATTGATCTCCACAGATTGGATGGTATGGGTTGCCTGGAGTTTGATGAGGAGCGAGCCC
AGAATCTGATGTCATTGATGATAGCCAANCTGGGGAAATCATGGTGAACTTCACAGGCTGGTTGAACAANNGTNAAGTGA
TCAGCCCTAGATTTAATGTGCAACTCAAAGACCCAGAAAATAGCGGANCAATNTGCTCTCACCTGNCACTGGCTTCCAGN
GNACTGACNNCTTCAGCTGGAGNCATGGACCATGAAGAACATGAGGAANACACACNCGAAGGGAAAATTCTTGTT
Sequence Type mRNA
Unitrap ID UNI26780

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107702491..107724951 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031885 (Cbfb) NM_022309 core binding factor beta Gene [Source:MGI Symbol;Acc:MGI:99851]

 
Come back to gene ENSMUSG00000031885


For any suggestions or comments, please send an email to unitrap@crg.es