Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRH203
Clone ID RRH203
Vector pGT0Lxf
Project baygenomics

Sequence tag RRH203
Sequence
CAGTGTGCGGCGAGGAAGGAGCGGAGCGAGACGCTGCGCCGGAGGTCTTTCCATAGACAACAGAAGCAAGGCTCCTATAA
TCAAAAGTGCCTCTTTGCTGAGTCATTGGGAAAAACTTGTCTGATCCAATCTGCTAGACTTGGAAAAGGGGAGTGACGAA
TCCAGCATCATACTGTGGAGTGGCCAAGATCTACCAGTGTGGGGGCATCAGACTTTGACCTTACGTTGGAAGATCTCAGA
GGATGCACCATGATGAAACGGCATAGACCTGTCAGCAGCAGTGAGAGTTCAGATGAGTGTCCTTCCACTTCCTTTACTTC
TAGCTCAATGTATAGGAAGAAGTCAAAAAATCCTAAGGAACAGAAGAAGTCTGCTG
Sequence Type mRNA
Unitrap ID UNI2076

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 20002913..20039315 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037315 (Phf16) NM_199317 PHD finger protein 16 Gene [Source:MGI (curated);Acc:Phf16-001]

 
Come back to gene ENSMUSG00000037315


For any suggestions or comments, please send an email to unitrap@crg.es