Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRH211
Clone ID RRH211
Vector pGT0Lxf
Project baygenomics

Sequence tag RRH211
Sequence
AGCCGGCGCCCGAAGTTCCACAGGAGCTATTCCGCGAGGTCAAGTACTACGCGGTGGGCGACATCGACCCGCAGGTTATT
CAGCTCCTTAAAGCTGGGAAAGCCAAGGAAGTCTCCTACAATGCCCTGGCCTCACACATCATTTCAGAGGATGGGGACAA
CCCAGAGGTGGGAGAAGCCCGTGAGGTCTTTGACTTGCCCGTTGTAA
Sequence Type mRNA
Unitrap ID UNI8185

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 28115185..28117812 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002221 (Paxip1) NM_018878 PAX interacting (with transcription-activation domain) protein 1 Gene [Source:MGI Symbol;Acc:MGI:1890430]

 
Come back to gene ENSMUSG00000002221


For any suggestions or comments, please send an email to unitrap@crg.es